nf-kb p65, human, recombinant active motif cat# 31102; lot# 12312015  (Active Motif)

Journal: Cell reports

Article Title: Zinc Finger Protein St18 Protects against Septic Death by Inhibiting VEGF-A from Macrophages.

doi: 10.1016/j.celrep.2020.107906

Figure Lengend Snippet: Figure 2. St18 Is Dispensable for Myeloid Lineage Development and NF-kB Activation (A) FACS analysis of LysM-St18flox/flox splenic cells with Ly6G and CD11b markers. Gated cells (Neu) were sorted and stained with May-Gr€unwald-Giemsa. (B) Bone marrow CD11b+ myeloid populations (top) were further analyzed with Ly6G and Ly6C markers. CD11b+ Ly6G+ Ly6Clo neutrophil populations and CD11b+ Ly6Glo Ly6C+ inflammatory monocyte populations are indicated (bottom). (C) MDMs and Neu from (A) were fixed and analyzed by transmission electron microscopy. Before the analysis, Neu were stained with diaminobenzidine. Scale bar, 1 mm. (D) MDMs from LysM-St18flox/flox mice were stimulated with various TLR ligands, Dectin1 ligands, Staphylococcus aureus (multiplicity of infection: 10) or Candida albicans (multiplicity of infection: 10) for 24 h. Supernatant cytokine levels were measured by ELISA (n = 3). (E) To obtain the transcriptome data, PEC from LysM-St18flox/flox mice were harvested and stimulated by LPS for 3 h, and total RNA from the cells was subjected to microarray analysis. Heatmap image of genes changed R3-fold than unstimulated (0 h) in control PEC was shown as described in Method Details. (F) Heatmap image of cytokine and chemokine genes excerpted from (E). (G) MDMs were stimulated with LPS; nuclear extracts were harvested, and DNA-binding activity of NF-kB p65 was evaluated (n = 3).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IL-6 ELISA R&D Systems Cat# M6000B Mouse IL-12 ELISA R&D Systems Cat# M1270 Mouse IL-1b ELISA R&D Systems Cat# DY401 VEGF ELISA kit R&D Systems Cat# MMV00 IGF-1 ELISA kit Thermo Scientific Cat# EMIGF1 Trans AM Transcription Factor Assay Kit for NF-kB p65 Active Motif Cat# 40096 Trans AM Transcription Factor Assay Kit for Sp1 Active Motif Cat# 41296 ReverTra Ace Toyobo Cat# FSQ-201 TaqMan Ribosomal control reagent kit Life Technologies Cat# 4308329 RNAeasy Mini Kit QIAGEN Cat# 74104 MethoCult Stem Cell Technologies Cat# GFM3434 High Salt Immune Complex Wash Buffer Millipore Cat# 20-155 Low Salt Immune Complex Wash Buffer Millipore Cat# 20-154 Etachinmate Nippon Gene Cat# 312-01791 Lipofectamine2000 reagent Invitrogen Cat# 11668030 Cell Desk Sumitomo Bakelite Cat# MS-92132 Epon812 TABB Cat# R3245 G-block Genostaff Cat# GB-01 Avidin/biotin blocking kit Vector Laboratories Cat# SP-2001 Mayer’s Hematoxylin MUTO Cat# 30001 Malinol MUTO Cat# 10781 Sp1 Reporter kit QIAGEN Cat# CCS-6027L Dual-Luciferase Reporter Assay System Promega Cat# E1910 BIONIX-1 hypoxic culture kit Sugiyamagen N/A Experimental Models: Cell Lines Cell line: RAW264.7 ATCC ATCC TIB-72 Experimental Models: Organisms/Strains Mouse: C57BL/6J Japan CLEA C57BL/6JJcl Mouse: St18tm1a(KOMP)Wtsi KOMP repository Strain ID: St18 tm1a Mouse: FLPo Cre Provided by M. Ikawa Yamazaki et al., 2016 Mouse: LysM-Cre Provided by S. Akira Clausen et al., 1999 Mouse: Villin-Cre Provided by S. Akira el Marjou et al., 2004 Mouse: ICE / Provided by S. Akira Gu et al., 1997 Oligonucleotides Genotyping DNA primers (Table S1) This paper N/A TaqMan Probes (Table S1) Life Technologies Cat# 4351372 Cat# 4331182 Primers used for VEGF-A promoter ChIP analysis Fw, GGTCACTCTAGTTGTCCCTA This paper N/A Primers used for VEGF-A promoter ChIP analysis Rv, TACCGCGAAATGGAAAGCTA This paper N/A Primers used for CCL2 promoter ChIP analysis Fw, TACCAAATTCCAACCCACAGTTTCTC Previously published Hildebrand et al., 2013 Primers used for CCL2 promoter ChIP analysis Rv, CTCTGCACTTCTGGCTGCTGCTCTG Previously published Hildebrand et al., 2013 VEGF-A Stealth RNAi TM siRNA Invitrogen Cat# MSS212359 Sp1 Stealth RNAi TM siRNA Invitrogen Cat# MSS209279 Recombinant DNA pLZR-IRES/GFP Previously published Kawagoe et al., 2009 (Continued on next page) e2 Cell Reports 32, 107906, July 14, 2020

Techniques: Activation Assay, Staining, Transmission Assay, Electron Microscopy, Infection, Enzyme-linked Immunosorbent Assay, Microarray, Control, Binding Assay, Activity Assay